KIAA1085

Product ID	ORK04876
Accession No	AB029008
Description	ankyrin repeat and KH domain containing 1
Clone name	hj07690
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5455 bp) Predicted protein sequence (584 aa)
Source	Human adult brain
Rouge ID	mKIAA1085 by Kazusa Mouse cDNA Project

Length: 5455 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3699 bp
Genome contig ID	gi51511721f_139788595
PolyA signal sequence (AGTAAA,-20)	+--------+--------+----*----+---- ACCTTCTGACTGCTTAGTAAACATTCAAAGAAATG
Flanking genome sequence (120754 - 120803)	----+--------+--------+--------+--------+----* CCTTGGCTCCAGTGTTCTCCTCAATGCTGATTTTCTCATCTCAGCCACAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	139888595	139909347	7	99.4	Perfect prediction

Length: 584 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB66877	4.8e-177	99.5	hypothetical pr...	Homo sapiens
EAW62060	5.3e-177	99.7	hCG1982388, iso...	Homo sapiens
XP_856763	9.7e-169	94.9	similar to mult...	Canis lupus fam...
XP_856682	9.7e-169	94.9	similar to mult...	Canis lupus fam...
XP_856640	1e-168	94.9	similar to mult...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014597	2.7e-24	36.2	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TCATCTACGACCGAAAGTTCC
Primer_r	AATTGTGCGTCATCGGGTATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-