Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK00184 |
|---|---|
| Accession No | AB032966 |
| Description | tetratricopeptide repeat domain 7A |
| Clone name | hk01004s1 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (4748 bp) Predicted protein sequence (752 aa) |
|
HaloTag ORF Clone |
FHC00184
|
| Flexi ORF Clone | FXC00184 |
| Source | Human adult brain |
| Rouge ID |
mKIAA1140
by Kazusa Mouse cDNA Project
|
| Note | We replaced hk01004, former representative clones for KIAA1140 with hk01004s1. (2002/5/10) |
Length: 4748 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 2223 bp |
|---|---|
| Genome contig ID | gi89161199f_46931064 |
| PolyA signal sequence (ATTAAA,-34) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (225718 - 225767) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 2 | f | 47031064 | 47156780 | 21 | 99.5 | Perfect prediction |
Length: 752 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001440 | 460 | 493 | PF00515 | Tetratricopeptide TPR_1 |
| IPR013105 | 639 | 672 | PF07719 | Tetratricopeptide TPR_2 | |
| IPR001440 | 707 | 740 | PF00515 | Tetratricopeptide TPR_1 | |
| HMMSmart | IPR013026 | 308 | 341 | SM00028 | Tetratricopeptide region |
| IPR013026 | 381 | 425 | SM00028 | Tetratricopeptide region | |
| IPR013026 | 460 | 493 | SM00028 | Tetratricopeptide region | |
| IPR013026 | 605 | 638 | SM00028 | Tetratricopeptide region | |
| IPR013026 | 639 | 672 | SM00028 | Tetratricopeptide region | |
| IPR013026 | 673 | 706 | SM00028 | Tetratricopeptide region | |
| IPR013026 | 707 | 740 | SM00028 | Tetratricopeptide region | |
| ProfileScan | IPR013026 | 274 | 341 | PS50293 | Tetratricopeptide region |
| IPR013026 | 308 | 341 | PS50005 | Tetratricopeptide region | |
| IPR013026 | 410 | 493 | PS50293 | Tetratricopeptide region | |
| IPR013026 | 426 | 459 | PS50005 | Tetratricopeptide region | |
| IPR013026 | 460 | 493 | PS50005 | Tetratricopeptide region | |
| IPR013026 | 605 | 638 | PS50005 | Tetratricopeptide region | |
| IPR013026 | 605 | 740 | PS50293 | Tetratricopeptide region | |
| IPR013026 | 639 | 672 | PS50005 | Tetratricopeptide region | |
| IPR013026 | 673 | 706 | PS50005 | Tetratricopeptide region | |
| IPR013026 | 707 | 740 | PS50005 | Tetratricopeptide region |
|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AGAAGTCCATACCAGTACACC |
|---|---|
| Primer_r | AATGAGCAGCGTTCTTTAGAG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 2 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | AGAAGTCCATACCAGTACACC |
| Primer_r | AATGAGCAGCGTTCTTTAGAG |
| PCR product length | 101 bp |
| PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |
Japan
||
Other countries
