KIAA1663

Product ID	ORK00882
Accession No	AB051450
Description	transducer of ERBB2, 2
Clone name	hk01115
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4314 bp) Predicted protein sequence (347 aa)
HaloTag ORF Clone	FHC00882
Flexi ORF Clone	FXC00882
Source	Human adult brain
Rouge ID	mKIAA1663 by Kazusa Mouse cDNA Project

Length: 4314 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2813 bp
Genome contig ID	gi89161203r_40059448
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GATTTTTTTAAGTTTGTATTAAAAGCATGATACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAGCCTTCTGCCTGCTCCTGGCTTGCTTGGTTTCTGGGGTCCCTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	40159448	40172732	2	99.1	Perfect prediction

Length: 347 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14106	5.7e-120	100.0	Protein Tob2; T...	Homo sapiens
AAV38899	5.7e-120	100.0	transducer of E...	synthetic construct
AAX37067	5.7e-120	100.0	transducer of E...	synthetic construct
CAH89879	3e-119	99.4	hypothetical pr...	Pongo abelii
XP_001502539	1.3e-114	96.2	similar to MGC1...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002087	32	61	PR00310	Anti-proliferative protein
	IPR002087	62	91	PR00310	Anti-proliferative protein
	IPR002087	92	121	PR00310	Anti-proliferative protein
HMMPfam	IPR002087	4	118	PF07742	Anti-proliferative protein
	IPR009818	131	148	PF07145	Ataxin-2
	IPR009818	251	268	PF07145	Ataxin-2
HMMSmart	IPR002087	4	109	SM00099	Anti-proliferative protein
ScanRegExp	IPR002087	43	63	PS00960	Anti-proliferative protein
ScanRegExp	IPR002087	89	108	PS01203	Anti-proliferative protein

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-