KIAA1984

Gene/Protein Characteristic Table for KIAA1984

Order Kazusa clone(s) from :

Product ID	ORK07145
Accession No	AB075864
Description	coiled-coil domain containing 183
Clone name	hk01547
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4207 bp) Predicted protein sequence (339 aa)
Source	Human adult brain

Features of the cloned cDNA sequence

Description

Length: 4207 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3096 bp
Genome contig ID	gi89161216f_138713532
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GTGGTGCATTTTGAATAAAAATAAAAGCTGATTTT
Flanking genome sequence (110778 - 110827)	----+--------+--------+--------+--------+----* AAATGTGTTATAATTGAAACTTTATACATAGCTGGCATTCGGAGAAGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	138813532	138824308	10	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 339 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB72078	1e-75	96.0	hypothetical pr...	Macaca fascicularis
XP_001093233	1.2e-75	96.0	hypothetical pr...	Macaca mulatta
EAW88266	3.8e-66	99.5	hCG2039834, iso...	Homo sapiens
BAC03931	3.8e-66	99.5	unnamed protein...	Homo sapiens
NP_001030579	1.1e-65	80.9	hypothetical pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TGAGTTTTTCCATCTTGCGGG
Primer_r	AATATCACGGAGGCTCTAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 9

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp