KIAA1646

Product ID	ORK04538
Accession No	AB051433
Description	ceramide kinase
Clone name	hk01650
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4171 bp) Predicted protein sequence (481 aa)
Source	Human adult brain
Rouge ID	mKIAA1646 by Kazusa Mouse cDNA Project

Length: 4171 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2724 bp
Genome contig ID	gi89161203r_45358972
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTTTGAGAAGACACGAATAAAGTTACTTGGGCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGGCTTGCTTTCTTTCCTTTACACATACCTGTTATTTTCAAAGCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	45458972	45495551	12	99.3	Perfect prediction

Length: 481 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8TCT0	0	100.0	Ceramide kinase...	Homo sapiens
EAW73438	0	100.0	ceramide kinase...	Homo sapiens
XP_001137835	0	99.8	ceramide kinase...	Pan troglodytes
XP_001111087	2.6e-214	98.5	similar to cera...	Macaca mulatta
XP_531694	1.2e-195	88.8	similar to cera...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	75	196	PD005043	Diacylglycerol kinase
HMMPfam	IPR001206	76	221	PF00781	Diacylglycerol kinase
HMMSmart	IPR001206	76	222	SM00046	Diacylglycerol kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-