Gene/Protein Characteristic Table for KIAA0655
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00593
Accession No AB014555
Description huntingtin interacting protein 1 related, transcript variant 1
Clone name hk01768
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4457 bp)
Predicted protein sequence (1083 aa)
Flexi ORF Clone FXC00593
Source Human adult brain
Rouge ID mKIAA0655 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4457 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1083 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75146 0 100.0 Huntingtin-inte...
Homo sapiens
CAH90311 0 98.4 hypothetical pr...
Pongo abelii
EDM13611 0 91.9 rCG21182, isofo...
Rattus norvegicus
NP_001128235 0 91.9 huntingtin inte...
Rattus norvegicus
XP_585048 0 90.8 similar to Hunt...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB028950 3.8e-06 22.7 KIAA1027
AB002318 7e-06 25.8 KIAA0320
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002558 768 1083 PD011820 I/LWEQ
HMMPfam IPR011417 43 315 PF07651 ANTH
IPR002558 834 1027 PF01608 I/LWEQ
HMMSmart IPR013809 44 166 SM00273 Epsin-like
IPR002558 829 1027 SM00307 I/LWEQ
ProfileScan IPR013809 38 166 PS50942 Epsin-like
IPR002558 786 1027 PS50945 I/LWEQ
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CCTTCTGGGGCACCGATTCTA
Primer_r ACATTCCTCTAGCCCACACAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 12
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTTCTGGGGCACCGATTCTA
Primer_r ACATTCCTCTAGCCCACACAG
PCR product length 80 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp