Order Kazusa clone(s) from : ![]() |
Product ID | ORK00593 |
---|---|
Accession No | AB014555 |
Description | huntingtin interacting protein 1 related, transcript variant 1 |
Clone name | hk01768 |
Vector information | |
cDNA sequence | DNA sequence (4457 bp) Predicted protein sequence (1083 aa) |
HaloTag ORF Clone |
FHC00593
![]() |
Flexi ORF Clone | FXC00593 |
Source | Human adult brain |
Rouge ID |
mKIAA0655
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002558 | 768 | 1083 | PD011820 | I/LWEQ |
HMMPfam | IPR011417 | 43 | 315 | PF07651 | ANTH |
IPR002558 | 834 | 1027 | PF01608 | I/LWEQ | |
HMMSmart | IPR013809 | 44 | 166 | SM00273 | Epsin-like |
IPR002558 | 829 | 1027 | SM00307 | I/LWEQ | |
ProfileScan | IPR013809 | 38 | 166 | PS50942 | Epsin-like |
IPR002558 | 786 | 1027 | PS50945 | I/LWEQ |
![]() |
---|
![]() |
Primer_f | CCTTCTGGGGCACCGATTCTA |
---|---|
Primer_r | ACATTCCTCTAGCCCACACAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTTCTGGGGCACCGATTCTA |
Primer_r | ACATTCCTCTAGCCCACACAG |
PCR product length | 80 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |