KIAA0320

Product ID	ORK07125
Accession No	AB002318
Description	talin 2
Clone name	bg00151
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6674 bp) Predicted protein sequence (1933 aa)
Source	Human adult brain
Rouge ID	mKIAA0320 by Kazusa Mouse cDNA Project
Note	We replaced hg00411, former representative clones for KIAA0320 with bg00151. (2002/5/10)

Length: 6674 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	871 bp
Genome contig ID	gi51511731f_60681613
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGGGGATTCTGCTGGAATAAAGAGCTTCCTCAGTG
Flanking genome sequence (239122 - 239171)	----+--------+--------+--------+--------+----* ACTCATCTTTAGGTCCCACGCTGGTTTCTGTGCCTTCAGAATGGTCACAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	60781613	60920733	42	100.0	Perfect prediction

Length: 1933 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW77617	100.0	talin 2, isofor...	Homo sapiens
NP_055874	100.0	talin 2 [Homo s...	Homo sapiens
Q9Y4G6	100.0	Talin-2.	Homo sapiens
AAM73764	99.9	talin 2 [Homo s...	Homo sapiens
XP_510461	99.7	talin 2 isoform...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028950	0	74.3	KIAA1027
AB014555	4.1e-13	25.8	KIAA0655

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002558	62	156	PD011820	I/LWEQ
	IPR002558	815	1015	PD011820	I/LWEQ
	IPR002558	1688	1921	PD011820	I/LWEQ
HMMPfam	IPR015224	1	46	PF09141	Talin
	IPR015009	1241	1365	PF08913	Vinculin Binding Site
	IPR015009	1403	1465	PF08913	Vinculin Binding Site
	IPR002558	1733	1924	PF01608	I/LWEQ
HMMSmart	IPR002558	1728	1924	SM00307	I/LWEQ
ProfileScan	IPR002558	1685	1924	PS50945	I/LWEQ
ScanRegExp	IPR006650	1460	1466	PS00485	Adenosine/AMP deaminase active site

Primer_f	TAGATACGACACAGGGCAGAG
Primer_r	TCATCCCACAAAACACGAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TAGATACGACACAGGGCAGAG
Primer_r	TCATCCCACAAAACACGAGGC
PCR product length	104 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles