Gene/Protein Characteristic Table for KIAA0660
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00112
Accession No AB014560
Description GTPase activating protein (SH3 domain) binding protein 2, transcript variant 2
Clone name hk01902
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4210 bp)
Predicted protein sequence (490 aa)
Flexi ORF Clone FXC00112
Source Human adult brain
Rouge ID mKIAA0660 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4210 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 490 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE26595 9.4e-146 98.4 unnamed protein...
Mus musculus
BAE31814 1.6e-145 98.2 unnamed protein...
Mus musculus
CAH91236 9.9e-145 99.8 hypothetical pr...
Pongo abelii
AAD51932 1.2e-144 99.8 RNA-binding pro...
Homo sapiens
XP_001100686 1.2e-144 99.8 similar to Ras-...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002075 19 141 PF02136 Nuclear transport factor 2
IPR000504 341 397 PF00076 RNA recognition motif
HMMSmart IPR000504 340 413 SM00360 RNA recognition motif
ProfileScan IPR002075 19 141 PS50177 Nuclear transport factor 2
IPR000504 339 417 PS50102 RNA recognition motif
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f TGCCCTGCCATCCATGAAAAC
Primer_r CTGAATGGCTCTTTGCTCTAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f TGCCCTGCCATCCATGAAAAC
Primer_r CTGAATGGCTCTTTGCTCTAC
PCR product length 91 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp