Gene/Protein Characteristic Table for KIAA0664
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05614
Accession No AB014564
Description clustered mitochondria (cluA/CLU1) homolog
Clone name hk02041
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4611 bp)
Predicted protein sequence (1134 aa)
Source Human adult brain
Rouge ID mKIAA0664 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4611 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 1134 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAH10532 0 99.8 hypothetical pr...
Homo sapiens
XP_001504428 0 95.9 similar to Puta...
Equus caballus
XP_548323 0 95.4 similar to Puta...
Canis lupus fam...
XP_888319 0 95.2 similar to Puta...
Bos taurus
XP_854494 0 95.3 similar to Puta...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB082531 1.4e-07 23.8 KIAA2000
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR002086 657 664 PS00687 Aldehyde dehydrogenase
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f GAATGTATCCCTCCCCTCAGT
Primer_r TCACGTCGGCACCTGTAACTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f GAATGTATCCCTCCCCTCAGT
Primer_r TCACGTCGGCACCTGTAACTC
PCR product length 117 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp