KIAA2000

Product ID	ORK06179
Accession No	AB082531
Description	nephronophthisis 3 (adolescent)
Clone name	bf00135
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7784 bp) Predicted protein sequence (699 aa)
Source	Human adult brain
Rouge ID	mKIAA2000 by Kazusa Mouse cDNA Project

Length: 7784 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3704 bp
Genome contig ID	gi89161205r_133659676
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TGAACATTAGGAATTAAAGGCTATATCTGGTCCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATTTTGTAATTTGTTTCTCTGTCTGAGGAAAGCTGGCTGGATTGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	133759676	133923993	45	99.7	Perfect prediction

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW79187	99.9	nephronophthisi...	Homo sapiens
Q7Z494	99.9	Nephrocystin-3.	Homo sapiens
XP_516758	99.0	nephronophthisi...	Pan troglodytes
XP_001115440	97.9	similar to neph...	Macaca mulatta
XP_001495737	94.7	nephronophthisi...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014564	5.7e-08	23.8	KIAA0664
AB058688	5.6e-05	26.4	KIAA1785
AB028966	5.8e-05	24.2	KIAA1043
D86981	0.0003	25.2	KIAA0228

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002151	428	447	PR00381	Kinesin light chain
	IPR002151	450	468	PR00381	Kinesin light chain
	IPR002151	515	532	PR00381	Kinesin light chain
	IPR002151	559	579	PR00381	Kinesin light chain
	IPR002151	594	615	PR00381	Kinesin light chain
HMMPfam	IPR001440	285	318	PF00515	Tetratricopeptide TPR_1
	IPR001440	327	360	PF00515	Tetratricopeptide TPR_1
	IPR001440	369	402	PF00515	Tetratricopeptide TPR_1
	IPR001440	435	468	PF00515	Tetratricopeptide TPR_1
	IPR001440	477	510	PF00515	Tetratricopeptide TPR_1
	IPR001440	519	552	PF00515	Tetratricopeptide TPR_1
	IPR001440	561	594	PF00515	Tetratricopeptide TPR_1
	IPR013105	603	636	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR013026	285	318	SM00028	Tetratricopeptide region
	IPR013026	327	360	SM00028	Tetratricopeptide region
	IPR013026	369	402	SM00028	Tetratricopeptide region
	IPR013026	435	468	SM00028	Tetratricopeptide region
	IPR013026	477	510	SM00028	Tetratricopeptide region
	IPR013026	519	552	SM00028	Tetratricopeptide region
	IPR013026	561	594	SM00028	Tetratricopeptide region
	IPR013026	603	636	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	285	318	PS50005	Tetratricopeptide region
	IPR013026	285	636	PS50293	Tetratricopeptide region
	IPR013026	327	360	PS50005	Tetratricopeptide region
	IPR013026	369	402	PS50005	Tetratricopeptide region
	IPR013026	435	468	PS50005	Tetratricopeptide region
	IPR013026	477	510	PS50005	Tetratricopeptide region
	IPR013026	519	552	PS50005	Tetratricopeptide region
	IPR013026	561	594	PS50005	Tetratricopeptide region
	IPR013026	603	636	PS50005	Tetratricopeptide region

Primer_f	CTAAACAAGACCAGCAAAGCC
Primer_r	CTGCCCAAATCCTTAGTCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-