Gene/Protein Characteristic Table for KIAA1043
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07241
Accession No AB028966
Description tetratricopeptide repeat domain 28
Clone name af02720
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7334 bp)
Predicted protein sequence (2126 aa)
Source Human brain (amygdala)
Rouge ID mKIAA1043 by Kazusa Mouse cDNA Project
Note We replaced fh02888 and fh17988, former representative clones for KIAA1043 with af02720. (2002/5/10,2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 7334 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 953 bp
Genome contig ID gi89161203r_26607256
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
AGGAAAGGTTGAAATGACTCCGTTTCCTTATAAGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTCCATGGCTAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 22 r 26707256 26889455 18 99.6 Perfect prediction
Features of the protein sequence
Description

Length: 2126 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96AY4 0 100.0 Tetratricopepti...
 Homo sapiens
XP_001172489 0 99.7 tetratricopepti...
 Pan troglodytes
XP_001108189 0 99.0 hypothetical pr...
 Macaca mulatta
XP_001495569 0 96.1 similar to Tetr...
 Equus caballus
XP_617836 0 93.8 similar to Tetr...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 1 32 PF00515 Tetratricopeptide TPR_1
IPR001440 39 72 PF00515 Tetratricopeptide TPR_1
IPR001440 119 152 PF00515 Tetratricopeptide TPR_1
IPR001440 159 192 PF00515 Tetratricopeptide TPR_1
IPR001440 199 232 PF00515 Tetratricopeptide TPR_1
IPR001440 239 272 PF00515 Tetratricopeptide TPR_1
IPR013105 279 312 PF07719 Tetratricopeptide TPR_2
IPR001440 319 352 PF00515 Tetratricopeptide TPR_1
IPR001440 359 392 PF00515 Tetratricopeptide TPR_1
IPR001440 399 432 PF00515 Tetratricopeptide TPR_1
IPR001440 439 472 PF00515 Tetratricopeptide TPR_1
IPR001440 479 512 PF00515 Tetratricopeptide TPR_1
IPR001440 522 555 PF00515 Tetratricopeptide TPR_1
IPR001440 562 595 PF00515 Tetratricopeptide TPR_1
IPR001440 602 635 PF00515 Tetratricopeptide TPR_1
IPR001440 642 675 PF00515 Tetratricopeptide TPR_1
IPR001440 682 715 PF00515 Tetratricopeptide TPR_1
IPR001440 722 755 PF00515 Tetratricopeptide TPR_1
HMMSmart IPR013026 2 32 SM00028 Tetratricopeptide region
IPR013026 39 72 SM00028 Tetratricopeptide region
IPR013026 79 112 SM00028 Tetratricopeptide region
IPR013026 119 152 SM00028 Tetratricopeptide region
IPR013026 159 192 SM00028 Tetratricopeptide region
IPR013026 199 232 SM00028 Tetratricopeptide region
IPR013026 239 272 SM00028 Tetratricopeptide region
IPR013026 279 312 SM00028 Tetratricopeptide region
IPR013026 319 352 SM00028 Tetratricopeptide region
IPR013026 359 392 SM00028 Tetratricopeptide region
IPR013026 399 432 SM00028 Tetratricopeptide region
IPR013026 439 472 SM00028 Tetratricopeptide region
IPR013026 479 512 SM00028 Tetratricopeptide region
IPR013026 522 555 SM00028 Tetratricopeptide region
IPR013026 562 595 SM00028 Tetratricopeptide region
IPR013026 602 635 SM00028 Tetratricopeptide region
IPR013026 642 675 SM00028 Tetratricopeptide region
IPR013026 682 715 SM00028 Tetratricopeptide region
IPR013026 722 755 SM00028 Tetratricopeptide region
IPR013026 762 795 SM00028 Tetratricopeptide region
ProfileScan IPR013026 1 795 PS50293 Tetratricopeptide region
IPR013026 3 32 PS50005 Tetratricopeptide region
IPR013026 39 72 PS50005 Tetratricopeptide region
IPR013026 79 112 PS50005 Tetratricopeptide region
IPR013026 119 152 PS50005 Tetratricopeptide region
IPR013026 159 192 PS50005 Tetratricopeptide region
IPR013026 199 232 PS50005 Tetratricopeptide region
IPR013026 239 272 PS50005 Tetratricopeptide region
IPR013026 279 312 PS50005 Tetratricopeptide region
IPR013026 319 352 PS50005 Tetratricopeptide region
IPR013026 359 392 PS50005 Tetratricopeptide region
IPR013026 399 432 PS50005 Tetratricopeptide region
IPR013026 439 472 PS50005 Tetratricopeptide region
IPR013026 479 512 PS50005 Tetratricopeptide region
IPR013026 522 555 PS50005 Tetratricopeptide region
IPR013026 562 595 PS50005 Tetratricopeptide region
IPR013026 602 635 PS50005 Tetratricopeptide region
IPR013026 642 675 PS50005 Tetratricopeptide region
IPR013026 682 715 PS50005 Tetratricopeptide region
IPR013026 722 755 PS50005 Tetratricopeptide region
IPR013026 762 795 PS50005 Tetratricopeptide region
Experimental conditions
Primer_f GCTCCCGACATAGACAAACTG
Primer_r TTCTTATTGTGCCGTGGTGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name GeneBridge 4
Primer_f GCTCCCGACATAGACAAACTG
Primer_r TTCTTATTGTGCCGTGGTGAC
PCR product length 197 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp