KIAA1785

Product ID	ORK00917
Accession No	AB058688
Description	fem-1 homolog c (C. elegans)
Clone name	fh12727
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5339 bp) Predicted protein sequence (617 aa)
HaloTag ORF Clone	FHC00917
Flexi ORF Clone	FXC00917
Source	Human fetal brain
Rouge ID	mKIAA1785 by Kazusa Mouse cDNA Project

Length: 5339 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3395 bp
Genome contig ID	gi51511721r_114784507
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTCATTGTAAGGTTTAATAAAATTAAATTTGCACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTTAAGTGTATTCTTATTAACTCAATACTTGATTGGTATTATCCTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	114884507	114907179	2	99.1	Perfect prediction

Length: 617 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A7MB89	99.8	Protein fem-1 h...	Bos taurus
XP_538557	99.7	similar to femi...	Canis lupus fam...
EDM14387	99.7	fem-1 homolog c...	Rattus norvegicus
XP_001504618	99.4	similar to LOC5...	Equus caballus
BAC33691	99.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007856	3.1e-78	40.7	KIAA0396
AB014597	1.9e-13	34.4	KIAA0697
AB051515	2.6e-12	31.9	KIAA1728
AB058779	6.2e-12	25.9	KIAA1876
AB046856	1.1e-11	31.6	KIAA1636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	41	53	PR01415	Ankyrin
FPrintScan	IPR002110	95	107	PR01415	Ankyrin
HMMPfam	IPR002110	40	73	PF00023	Ankyrin
	IPR002110	82	114	PF00023	Ankyrin
	IPR002110	115	147	PF00023	Ankyrin
	IPR002110	148	180	PF00023	Ankyrin
	IPR002110	181	206	PF00023	Ankyrin
	IPR002110	213	236	PF00023	Ankyrin
	IPR002110	481	526	PF00023	Ankyrin
	IPR002110	527	559	PF00023	Ankyrin
HMMSmart	IPR002110	2	33	SM00248	Ankyrin
	IPR002110	40	70	SM00248	Ankyrin
	IPR002110	82	111	SM00248	Ankyrin
	IPR002110	115	144	SM00248	Ankyrin
	IPR002110	148	177	SM00248	Ankyrin
	IPR002110	181	210	SM00248	Ankyrin
	IPR002110	213	243	SM00248	Ankyrin
	IPR002110	481	523	SM00248	Ankyrin
	IPR002110	527	556	SM00248	Ankyrin
ProfileScan	IPR002110	2	233	PS50297	Ankyrin
	IPR002110	40	62	PS50088	Ankyrin
	IPR002110	82	114	PS50088	Ankyrin
	IPR002110	115	147	PS50088	Ankyrin
	IPR002110	148	180	PS50088	Ankyrin
	IPR002110	181	213	PS50088	Ankyrin
	IPR002110	481	526	PS50088	Ankyrin
	IPR002110	481	559	PS50297	Ankyrin
	IPR002110	527	559	PS50088	Ankyrin

Primer_f	AACATGAGGTACAGTGATAGG
Primer_r	TAGTGCCTGCATTCTCATCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-