Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04144 |
---|---|
Accession No | D86981 |
Description | amyloid beta precursor protein (cytoplasmic tail) binding protein 2, transcript variant 1 |
Clone name | ha04738 |
Vector information | |
cDNA sequence | DNA sequence (6465 bp) Predicted protein sequence (681 aa) |
HaloTag ORF Clone |
FHC04144
|
Flexi ORF Clone | FXC04144 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0228
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4419 bp |
---|---|
Genome contig ID | gi51511734r_55775302 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 55875302 | 55958362 | 13 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR013026 | 342 | 375 | SM00028 | Tetratricopeptide region |
IPR013026 | 525 | 558 | SM00028 | Tetratricopeptide region | |
IPR013026 | 567 | 601 | SM00028 | Tetratricopeptide region | |
ProfileScan | IPR013026 | 384 | 417 | PS50005 | Tetratricopeptide region |
IPR013026 | 525 | 558 | PS50005 | Tetratricopeptide region | |
IPR013026 | 525 | 558 | PS50293 | Tetratricopeptide region |
Panel name | Genebridge 4 |
---|---|
Primer_f | AGATCAGCGCTGGGACGGAAC |
Primer_r | GCAGGCCCGAGTAAAAAGTGG |
PCR product length | 103 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |