Gene/Protein Characteristic Table for KIAA0730
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06722
Accession No AB018273
Description sacsin molecular chaperone
Clone name hk03632
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4318 bp)
Predicted protein sequence (1004 aa)
Source Human adult brain
Rouge ID mKIAA0730 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4318 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1004 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAF31262 0 100.0 sacsin [Homo sa...
Homo sapiens
Q9NZJ4 0 100.0 Sacsin.
Homo sapiens
XP_001174272 0 99.8 sacsin [Pan tro...
Pan troglodytes
XP_001089852 0 99.4 similar to sacs...
Macaca mulatta
XP_001089964 0 99.4 similar to sacs...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007842 872 999 PF05168 HEPN
HMMSmart IPR007842 876 992 SM00748 HEPN
ProfileScan IPR001623 731 818 PS50076 Heat shock protein DnaJ
IPR007842 876 992 PS50910 HEPN
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCAACGGAAAACTCAAAATGG
Primer_r ACTCCACTACATGCCATATTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name GeneBridge 4
Primer_f GCAACGGAAAACTCAAAATGG
Primer_r ACTCCACTACATGCCATATTG
PCR product length 244 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp