Order Kazusa clone(s) from : ![]() |
Product ID | ORK00616 |
---|---|
Accession No | AB018276 |
Description | TGF-beta activated kinase 1/MAP3K7 binding protein 2, transcript variant 1 |
Clone name | hk03729s1 |
Vector information | |
cDNA sequence | DNA sequence (4149 bp) Predicted protein sequence (698 aa) |
HaloTag ORF Clone |
FHC00616
![]() |
Flexi ORF Clone | FXC00616 |
Source | Human adult brain |
Rouge ID |
mKIAA0733
by Kazusa Mouse cDNA Project
|
Note | We replaced hk03729, former representative clones for KIAA0733 with hk03729s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1892 bp |
---|---|
Genome contig ID | gi89161210f_149632737 |
PolyA signal sequence (ATTAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (141705 - 141754) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 149680756 | 149774440 | 7 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003892 | 13 | 55 | PF02845 | Ubiquitin system component Cue |
HMMSmart | IPR003892 | 13 | 55 | SM00546 | Ubiquitin system component Cue |
IPR001876 | 671 | 695 | SM00547 | Zinc finger | |
ProfileScan | IPR003892 | 13 | 56 | PS51140 | Ubiquitin system component Cue |
IPR001876 | 668 | 698 | PS50199 | Zinc finger | |
ScanRegExp | IPR001876 | 673 | 692 | PS01358 | Zinc finger |
![]() |
Primer_f | TTCTAATCCTGACTTGGTGAC |
---|---|
Primer_r | AGAGATGCTTGAGGTTGCTTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |