Gene/Protein Characteristic Table for KIAA0733
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00616
Accession No AB018276
Description TGF-beta activated kinase 1/MAP3K7 binding protein 2, transcript variant 1
Clone name hk03729s1
Vector information
The cDNA fragment was originally inserted at SalI-NotI site ...
cDNA sequence DNA sequence (4149 bp)
Predicted protein sequence (698 aa)
Flexi ORF Clone FXC00616
Source Human adult brain
Rouge ID mKIAA0733 by Kazusa Mouse cDNA Project
Note We replaced hk03729, former representative clones for KIAA0733 with hk03729s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4149 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1892 bp
Genome contig ID gi89161210f_149632737
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
ATTTATAAAAATTAAAAAACTTATATTCTAATGTG
Flanking genome sequence
(141705 - 141754)
----+----*----+----*----+----*----+----*----+----*
GATTTTGTGACTTGTTTTCAGTTTGTGGGACAGGAGATAATTTATACATC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 6 f 149680756 149774440 7 99.9 Perfect prediction
Features of the protein sequence
Description

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NYJ8 0 100.0 Mitogen-activat...
Homo sapiens
XP_001084664 0 99.7 similar to mito...
Macaca mulatta
XP_541145 0 96.5 similar to mito...
Canis lupus fam...
XP_592279 0 96.7 similar to mito...
Bos taurus
XP_001502204 0 96.4 mitogen-activat...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003892 13 55 PF02845 Ubiquitin system component Cue
HMMSmart IPR003892 13 55 SM00546 Ubiquitin system component Cue
IPR001876 671 695 SM00547 Zinc finger
ProfileScan IPR003892 13 56 PS51140 Ubiquitin system component Cue
IPR001876 668 698 PS50199 Zinc finger
ScanRegExp IPR001876 673 692 PS01358 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TTCTAATCCTGACTTGGTGAC
Primer_r AGAGATGCTTGAGGTTGCTTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp