KIAA0733

Product ID	ORK00616
Accession No	AB018276
Description	TGF-beta activated kinase 1/MAP3K7 binding protein 2, transcript variant 1
Clone name	hk03729s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1- 2311) was subcloned upstream of the cDNA (2312-4149). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGCAGCT GAAGCTTTCA CAAGTTTGTA CAAAAAAGCA GGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (4149 bp) Predicted protein sequence (698 aa)
HaloTag ORF Clone	FHC00616
Flexi ORF Clone	FXC00616
Source	Human adult brain
Rouge ID	mKIAA0733 by Kazusa Mouse cDNA Project
Note	We replaced hk03729, former representative clones for KIAA0733 with hk03729s1. (2002/5/10)

Length: 4149 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1892 bp
Genome contig ID	gi89161210f_149632737
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- ATTTATAAAAATTAAAAAACTTATATTCTAATGTG
Flanking genome sequence (141705 - 141754)	----+--------+--------+--------+--------+----* GATTTTGTGACTTGTTTTCAGTTTGTGGGACAGGAGATAATTTATACATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	149680756	149774440	7	99.9	Perfect prediction

Length: 698 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NYJ8	100.0	Mitogen-activat...	Homo sapiens
XP_001084664	99.7	similar to mito...	Macaca mulatta
XP_541145	96.5	similar to mito...	Canis lupus fam...
XP_592279	96.7	similar to mito...	Bos taurus
XP_001502204	96.4	mitogen-activat...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003892	13	55	PF02845	Ubiquitin system component Cue
HMMSmart	IPR003892	13	55	SM00546	Ubiquitin system component Cue
HMMSmart	IPR001876	671	695	SM00547	Zinc finger
ProfileScan	IPR003892	13	56	PS51140	Ubiquitin system component Cue
ProfileScan	IPR001876	668	698	PS50199	Zinc finger
ScanRegExp	IPR001876	673	692	PS01358	Zinc finger

Primer_f	TTCTAATCCTGACTTGGTGAC
Primer_r	AGAGATGCTTGAGGTTGCTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-