KIAA0691

Product ID	ORK01111
Accession No	AB014591
Description	CCR4-NOT transcription complex, subunit 3
Clone name	hk03735
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk03735 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4133 bp) Predicted protein sequence (762 aa)
HaloTag ORF Clone	FHC01111
Flexi ORF Clone	FXC01111
Source	Human adult brain
Rouge ID	mKIAA0691 by Kazusa Mouse cDNA Project

Length: 4133 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	273 bp
Genome contig ID	gi42406306f_59236924
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTGGAAAATATTTATGAATAAATAGTTTTATATG
Flanking genome sequence (114308 - 114357)	----+--------+--------+--------+--------+----* ACGGCTGGCAGCAGCGGCCTCTCCTGTACCCCCTCAGGAGTCAGTGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	59336924	59351230	17	99.5	Perfect prediction

Length: 762 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75175	1.9e-169	100.0	CCR4-NOT transc...	Homo sapiens
ABX52171	4.5e-167	98.9	CCR4-NOT transc...	Papio anubis
ACH53093	2.5e-165	97.6	CCR4-NOT transc...	Otolemur garnettii
XP_541428	1e-163	96.7	similar to CCR4...	Canis lupus fam...
ACK44299	6.4e-163	96.5	CCR4-NOT transc...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007207	11	251	PF04065	Not CCR4-Not complex component
HMMPfam	IPR007282	589	757	PF04153	NOT2/NOT3/NOT5

Primer_f	CAAGGCCCTAAAGAAGCAGTC
Primer_r	GTCAAAGTAGATGTAGGTGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TAGTAACAGCAGTGCCGGTGG
Primer_r	CTGAGTTGTTCCCTGAGCCTG
PCR product length	242 bp
PCR conditions	95 °C15 sec70 °C60 sec30 cycles