Order Kazusa clone(s) from : ![]() |
Product ID | ORK07365 |
---|---|
Accession No | AB029013 |
Description | Wolf-Hirschhorn syndrome candidate 1 |
Clone name | hk03921a |
Vector information | |
cDNA sequence | DNA sequence (2670 bp) Predicted protein sequence (715 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1090
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 6 bp |
---|---|
Genome contig ID | gi89161207f_1823630 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (126812 - 126861) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 1923627 | 1950440 | 12 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 183 | 225 | PF00628 | Zinc finger |
IPR000313 | 227 | 301 | PF00855 | PWWP | |
IPR001214 | 407 | 536 | PF00856 | SET | |
IPR001965 | 591 | 638 | PF00628 | Zinc finger | |
HMMSmart | IPR001965 | 66 | 113 | SM00249 | Zinc finger |
IPR001965 | 183 | 223 | SM00249 | Zinc finger | |
IPR000313 | 228 | 290 | SM00293 | PWWP | |
IPR006560 | 361 | 412 | SM00570 | AWS | |
IPR001214 | 413 | 536 | SM00317 | SET | |
IPR003616 | 537 | 553 | SM00508 | Post-SET zinc-binding region | |
IPR001965 | 591 | 634 | SM00249 | Zinc finger | |
ProfileScan | IPR001841 | 67 | 113 | PS50089 | Zinc finger |
IPR001965 | 181 | 225 | PS50016 | Zinc finger | |
IPR000313 | 230 | 292 | PS50812 | PWWP | |
IPR006560 | 361 | 411 | PS51215 | AWS | |
IPR001214 | 412 | 534 | PS50280 | SET | |
IPR003616 | 537 | 553 | PS50868 | Post-SET zinc-binding region | |
ScanRegExp | IPR001965 | 184 | 222 | PS01359 | Zinc finger |
![]() |
Primer_f | CCCAATTCGTTCTGTAAGGAG |
---|---|
Primer_r | GCTATTTGCCCTCTGTGACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCCAATTCGTTCTGTAAGGAG |
Primer_r | GCTATTTGCCCTCTGTGACTC |
PCR product length | 202 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |