Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK01116 |
|---|---|
| Accession No | AB018282 |
| Description | solute carrier family 4, sodium bicarbonate cotransporter, member 8 |
| Clone name | hk03925 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (4079 bp) Predicted protein sequence (1130 aa) |
|
HaloTag ORF Clone |
FHC01116
|
| Flexi ORF Clone | FXC01116 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0739
by Kazusa Mouse cDNA Project
|
Length: 4079 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 686 bp |
|---|---|
| Genome contig ID | gi89161190f_49971399 |
| PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (206518 - 206567) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 12 | f | 50071399 | 50177915 | 24 | 99.7 | Perfect prediction |
Length: 1130 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR003024 | 232 | 238 | PR01232 | Na+/HCO3- transporter |
| IPR003020 | 420 | 432 | PR01231 | HCO3- transporter | |
| IPR003024 | 430 | 438 | PR01232 | Na+/HCO3- transporter | |
| IPR003024 | 471 | 479 | PR01232 | Na+/HCO3- transporter | |
| IPR003024 | 481 | 489 | PR01232 | Na+/HCO3- transporter | |
| IPR003024 | 491 | 503 | PR01232 | Na+/HCO3- transporter | |
| IPR003020 | 554 | 563 | PR01231 | HCO3- transporter | |
| IPR003020 | 579 | 590 | PR01231 | HCO3- transporter | |
| IPR003024 | 618 | 625 | PR01232 | Na+/HCO3- transporter | |
| IPR003024 | 665 | 672 | PR01232 | Na+/HCO3- transporter | |
| IPR003020 | 669 | 681 | PR01231 | HCO3- transporter | |
| IPR003020 | 690 | 702 | PR01231 | HCO3- transporter | |
| IPR003020 | 817 | 826 | PR01231 | HCO3- transporter | |
| IPR003020 | 881 | 890 | PR01231 | HCO3- transporter | |
| IPR003020 | 895 | 908 | PR01231 | HCO3- transporter | |
| HMMPfam | IPR013769 | 231 | 490 | PF07565 | HCO3- transporter |
| IPR011531 | 530 | 1044 | PF00955 | HCO3-transporter | |
| HMMTigr | IPR003020 | 203 | 1119 | TIGR00834 | HCO3- transporter |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 563 | QCLASFLFLYCACMSPVITFGGL | 585 | PRIMARY | 23 | 2 | 604 | SMTGIAYSLFAGQALTILGSTGP | 626 | SECONDARY | 23 | 3 | 650 | ACIGLWTAFLCIVLVATDASSLV | 672 | PRIMARY | 23 | 4 | 680 | EEAFASLICIIFIYEAIEKLIHL | 702 | PRIMARY | 23 | 5 | 777 | TPDVLFWSCILFFTTFILSSTLK | 799 | SECONDARY | 23 | 6 | 816 | SDFAVFLTIFTMVIIDFLIGVPS | 838 | PRIMARY | 23 | 7 | 862 | GPNPWWTVIAAIIPALLCTILIF | 884 | PRIMARY | 23 | 8 | 913 | MVAIMLGVCSIMGLPWFVAATVL | 935 | PRIMARY | 23 | 9 | 974 | LMGCSVFMTAILKFIPMPVLYGV | 996 | PRIMARY | 23 | 10 | 1030 | LRHVPLRKVHLFTLIQLTCLVLL | 1052 | PRIMARY | 23 | 11 | 1059 | PAAIVFPMMVLALVFVRKVMDLC | 1081 | PRIMARY | 23 |
|---|
|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | AGCACTTGGCATCTTGTCATC |
|---|---|
| Primer_r | CTCACTCATTTCTTGGTCTGG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 12 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | AGCACTTGGCATCTTGTCATC |
| Primer_r | CTCACTCATTTCTTGGTCTGG |
| PCR product length | 107 bp |
| PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |
Japan
||
Other countries
