KIAA1505

Product ID	ORK07668
Accession No	AB040938
Description	coiled-coil domain containing 146
Clone name	hk04292
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4447 bp) Predicted protein sequence (693 aa)
Source	Human adult brain
Rouge ID	mKIAA1505 by Kazusa Mouse cDNA Project

Length: 4447 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	350 bp
Genome contig ID	gi89161213f_76625467
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAATCTGTTCTCAATGAAGTACGGAAATGG
Flanking genome sequence (137004 - 137053)	----+--------+--------+--------+--------+----* ACACAGTGGTCTTTGTTTATTAAAGAAAAAACAAATACTGTTCAATATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	76725151	76762469	11	98.9	Perfect prediction

Length: 693 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL03207	3.6e-164	79.0	mCG120103, isof...	Mus musculus
EDL99429	2.9e-163	78.7	hypothetical pr...	Rattus norvegicus
AAH36053	1.8e-162	95.2	Coiled-coil dom...	Homo sapiens
BAF85180	6.5e-162	95.0	unnamed protein...	Homo sapiens
XP_519167	7.2e-161	94.7	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007914	0.00023	21.6	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	8	RQVCVCVCVCVCIPYREME	26	PRIMARY	19

Primer_f	AACAAATCCAGGCCTCTCAAG
Primer_r	CTGTTGTACTCTGTTGCTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACAAATCCAGGCCTCTCAAG
Primer_r	CTGTTGTACTCTGTTGCTGAC
PCR product length	135 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles