Order Kazusa clone(s) from : ![]() |
Product ID | ORK00132 |
---|---|
Accession No | AB018351 |
Description | thymocyte selection-associated high mobility group box |
Clone name | hk04477s1 |
Vector information | |
cDNA sequence | DNA sequence (4133 bp) Predicted protein sequence (530 aa) |
Flexi ORF Clone | FXC00132 |
Source | Human adult brain |
Note | We replaced hk04477, former representative clones for KIAA0808 with hk04477s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2329 bp |
---|---|
Genome contig ID | gi51511724r_59780531 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 59880531 | 60194321 | 9 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000135 | 280 | 298 | PR00886 | High mobility group box HMG1 and HMG2 |
IPR000135 | 298 | 317 | PR00886 | High mobility group box HMG1 and HMG2 | |
IPR000135 | 317 | 337 | PR00886 | High mobility group box HMG1 and HMG2 | |
HMMPfam | IPR000910 | 265 | 333 | PF00505 | HMG1/2 (high mobility group) box |
HMMSmart | IPR000910 | 264 | 334 | SM00398 | HMG1/2 (high mobility group) box |
ProfileScan | IPR000910 | 265 | 333 | PS50118 | HMG1/2 (high mobility group) box |
![]() |
Primer_f | TTACTGGGAGGAGAATGAGCA |
---|---|
Primer_r | TCAACACTCTCTACCCTGGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |