KIAA0757

Gene/Protein Characteristic Table for KIAA0757

Order Kazusa clone(s) from :

Product ID	ORK00624
Accession No	AB018300
Description	spermatogenesis associated 2, transcript variant 1
Clone name	hk04606
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3970 bp) Predicted protein sequence (534 aa)
HaloTag ORF Clone	FHC00624
Flexi ORF Clone	FXC00624
Source	Human adult brain
Rouge ID	mKIAA0757 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3970 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2223 bp
Genome contig ID	gi51511747r_47853338
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTAAAAATAATAATAATAAAGTGTCTTCCATTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGAAGTGTTTGGGGTTTTATGTCCCCTGGCCCTGCTTTGAAGTTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	47953338	47965405	3	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UM82	5.3e-202	100.0	Spermatogenesis...	Homo sapiens
AAD28324	9.2e-202	99.8	spermatogenesis...	Homo sapiens
XP_514717	1.6e-201	99.8	spermatogenesis...	Pan troglodytes
BAF82333	2.4e-201	99.8	unnamed protein...	Homo sapiens
BAG51170	1.7e-200	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TTTCTAACCAACCGTGATGCC
Primer_r	AATCACAGCAACCTCATCCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 20

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp