|
Order Kazusa clone(s) from : |
| Product ID | ORK00125 |
|---|---|
| Accession No | AB018304 |
| Description | chloride channel CLIC-like 1, transcript variant 1 |
| Clone name | hk04655s1 |
| Vector information | |
| cDNA sequence | DNA sequence (4696 bp) Predicted protein sequence (551 aa) |
|
HaloTag ORF Clone |
FHC00125
|
| Flexi ORF Clone | FXC00125 |
| Source | Human adult brain |
| Note | We replaced hk04655, former representative clones for KIAA0761 with hk04655s1. (2002/12/27) |
Length: 4696 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3039 bp |
|---|---|
| Genome contig ID | gi89161185r_109173653 |
| PolyA signal sequence (AAGAAA,-21) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | r | 109273653 | 109294583 | 11 | 99.3 | Perfect prediction |
Length: 551 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR009231 | 3 | 551 | PF05934 | Mid-1-related chloride channel |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | MLCSLLLCECLLLVAGYAHDDDW | 23 | PRIMARY | 23 | 2 | 181 | DPYNVLMVLLCLLCIVVLVATEL | 203 | PRIMARY | 23 | 3 | 216 | VLIISFLFSLGWNWMYLYKLAFA | 238 | SECONDARY | 23 | 4 | 329 | EIPALLHLPVLIIMALAILSFCY | 351 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CTGTTCATCCATTCTCTTTCC |
|---|---|
| Primer_r | GACTGAGAGATTTAACATAGC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CTGTTCATCCATTCTCTTTCC |
| Primer_r | GACTGAGAGATTTAACATAGC |
| PCR product length | 197 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |