KIAA0844

Product ID	ORK00654
Accession No	AB020651
Description	zinc finger protein 365, transcript variant A
Clone name	hk05227
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4158 bp) Predicted protein sequence (438 aa)
HaloTag ORF Clone	FHC00654
Flexi ORF Clone	FXC00654
Source	Human adult brain
Rouge ID	mKIAA0844 by Kazusa Mouse cDNA Project

Length: 4158 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2657 bp
Genome contig ID	gi89161187f_63703957
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAAATATTATGATAATAAAGCTATATTTCTGACT
Flanking genome sequence (128258 - 128307)	----+--------+--------+--------+--------+----* AATGTGTTGATATGTTTTGTCTAGTTGGAGTGTTTTTTGGGGAGCCAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	63803957	63832213	5	99.2	Perfect prediction

Length: 438 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI46100	2.5e-148	100.0	hypothetical pr...	Homo sapiens
Q70YC5	7.1e-147	100.0	Protein ZNF365.	Homo sapiens
EAW54234	1.2e-146	99.8	zinc finger pro...	Homo sapiens
XP_001165752	7.9e-146	99.3	zinc finger pro...	Pan troglodytes
Q5R9L2	1.1e-143	98.0	Protein ZNF365.	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075820	2.3e-10	39.5	KIAA1940

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	ATGTATGTTGTGCCTCCTTAG
Primer_r	ACAGGACATGGTACTTAGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-