Order Kazusa clone(s) from : ![]() |
Product ID | ORK00655 |
---|---|
Accession No | AB020652 |
Description | neurofilament, heavy polypeptide |
Clone name | hk05234s1 |
Vector information | |
cDNA sequence | DNA sequence (3929 bp) Predicted protein sequence (1034 aa) |
HaloTag ORF Clone |
FHC00655
![]() |
Flexi ORF Clone | FXC00655 |
Source | Human adult brain |
Rouge ID |
mKIAA0845
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05234, former representative clones for KIAA0845 with hk05234s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 583 bp |
---|---|
Genome contig ID | gi89161203f_28106243 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (111034 - 111083) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | f | 28196907 | 28217275 | 9 | 98.6 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001664 | 104 | 420 | PF00038 | Intermediate filament protein |
IPR010790 | 549 | 579 | PF07142 | Protein of unknown function DUF1388 | |
IPR010790 | 583 | 613 | PF07142 | Protein of unknown function DUF1388 | |
IPR010790 | 618 | 647 | PF07142 | Protein of unknown function DUF1388 | |
ScanRegExp | IPR001664 | 407 | 415 | PS00226 | Intermediate filament protein |
![]() |
Primer_f | TGAGATGTCTTAACCTATTCC |
---|---|
Primer_r | AAGCAATTGAAAGTGAACTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |