Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04188 |
---|---|
Accession No | AB018331 |
Description | small nuclear ribonucleoprotein 200kDa (U5) |
Clone name | hk05526s2 |
Vector information | |
cDNA sequence | DNA sequence (6754 bp) Predicted protein sequence (2026 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0788
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05526, former representative clones for KIAA0788 with hk05526s2. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 673 bp |
---|---|
Genome contig ID | gi89161199r_96203804 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 96303804 | 96332674 | 43 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011545 | 372 | 551 | PF00270 | DNA/RNA helicase |
IPR001650 | 664 | 750 | PF00271 | DNA/RNA helicase | |
IPR004179 | 871 | 1176 | PF02889 | Sec63 | |
IPR011545 | 1219 | 1390 | PF00270 | DNA/RNA helicase | |
IPR001650 | 1502 | 1585 | PF00271 | DNA/RNA helicase | |
IPR004179 | 1702 | 2014 | PF02889 | Sec63 | |
HMMSmart | IPR014001 | 367 | 580 | SM00487 | DEAD-like helicases |
IPR001650 | 658 | 750 | SM00490 | DNA/RNA helicase | |
IPR004179 | 868 | 1177 | SM00611 | Sec63 | |
IPR014001 | 1214 | 1418 | SM00487 | DEAD-like helicases | |
IPR001650 | 1497 | 1585 | SM00490 | DNA/RNA helicase | |
IPR004179 | 1699 | 2015 | SM00611 | Sec63 | |
ProfileScan | IPR014021 | 380 | 563 | PS51192 | Helicase |
IPR001650 | 574 | 811 | PS51194 | DNA/RNA helicase | |
IPR014021 | 1227 | 1402 | PS51192 | Helicase | |
IPR001650 | 1435 | 1643 | PS51194 | DNA/RNA helicase |
RT-PCR-ELISA |
Primer_f | AAGTCCAATAGCCTCATCTCC |
---|---|
Primer_r | ATCTGAATCACTGTCTGTCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |