KIAA0788

Product ID	ORK04188
Accession No	AB018331
Description	small nuclear ribonucleoprotein 200kDa (U5)
Clone name	hk05526s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6754 bp) Predicted protein sequence (2026 aa)
Source	Human adult brain
Rouge ID	mKIAA0788 by Kazusa Mouse cDNA Project
Note	We replaced hk05526, former representative clones for KIAA0788 with hk05526s2. (2002/5/10)

Length: 6754 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	673 bp
Genome contig ID	gi89161199r_96203804
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTGACCCAGTCTTAATAAACAGGTTTTCTAATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATCTTCCGACTGTCTTCAAATTCTTACCTTCTGTTCTTTAGATTAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	96303804	96332674	43	100.0	Perfect prediction

Length: 2026 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75643	100.0	U5 small nuclea...	Homo sapiens
AAS78571	100.0	200 kDa U5 snRN...	Homo sapiens
XP_001492729	99.9	activating sign...	Equus caballus
AAH63261	99.7	Activating sign...	Mus musculus
EDL28177	99.7	activating sign...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29641	1.7e-07	25.3	KIAA0052
AB018344	0.00011	23.4	KIAA0801

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	372	551	PF00270	DNA/RNA helicase
	IPR001650	664	750	PF00271	DNA/RNA helicase
	IPR004179	871	1176	PF02889	Sec63
	IPR011545	1219	1390	PF00270	DNA/RNA helicase
	IPR001650	1502	1585	PF00271	DNA/RNA helicase
	IPR004179	1702	2014	PF02889	Sec63
HMMSmart	IPR014001	367	580	SM00487	DEAD-like helicases
	IPR001650	658	750	SM00490	DNA/RNA helicase
	IPR004179	868	1177	SM00611	Sec63
	IPR014001	1214	1418	SM00487	DEAD-like helicases
	IPR001650	1497	1585	SM00490	DNA/RNA helicase
	IPR004179	1699	2015	SM00611	Sec63
ProfileScan	IPR014021	380	563	PS51192	Helicase
	IPR001650	574	811	PS51194	DNA/RNA helicase
	IPR014021	1227	1402	PS51192	Helicase
	IPR001650	1435	1643	PS51194	DNA/RNA helicase

Primer_f	AAGTCCAATAGCCTCATCTCC
Primer_r	ATCTGAATCACTGTCTGTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-