KIAA0099

Product ID	ORK01054
Accession No	D43951
Description	pumilio RNA-binding family member 1
Clone name	hk05583
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3936 bp) Predicted protein sequence (1175 aa)
HaloTag ORF Clone	FHC01054
Flexi ORF Clone	FXC01054
Source	Human adult brain
Rouge ID	mKIAA0099 by Kazusa Mouse cDNA Project
Note	We replaced ha03551, former representative clones for KIAA0099 with hk05583. (2001/10/06)

Length: 3936 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	367 bp
Genome contig ID	gi89161185r_31078294
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAGGGTGGTTGGTTTAACAAAAAAAAAAAGCTTT
Flanking genome sequence (99984 - 99935)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAAAAAAAGGAAAAGGTTTTTAGCTCATTTGCCTGGCCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	31178278	31311118	22	99.9	Perfect prediction

Length: 1175 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11135	100.0	pumilio homolog...	synthetic construct
XP_001096958	99.9	similar to Pumi...	Macaca mulatta
XP_865286	99.4	similar to pumi...	Canis lupus fam...
XP_001157494	94.7	pumilio 1 isofo...	Pan troglodytes
XP_001140088	79.0	pumilio homolog...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87078	6.8e-98	76.6	KIAA0235
D13645	0.00022	21.1	KIAA0020

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001313	835	869	PF00806	Pumilio/Puf RNA-binding
	IPR001313	871	905	PF00806	Pumilio/Puf RNA-binding
	IPR001313	907	942	PF00806	Pumilio/Puf RNA-binding
	IPR001313	945	979	PF00806	Pumilio/Puf RNA-binding
	IPR001313	981	1015	PF00806	Pumilio/Puf RNA-binding
	IPR001313	1017	1051	PF00806	Pumilio/Puf RNA-binding
	IPR001313	1053	1088	PF00806	Pumilio/Puf RNA-binding
	IPR001313	1096	1130	PF00806	Pumilio/Puf RNA-binding
HMMSmart	IPR001313	835	870	SM00025	Pumilio/Puf RNA-binding
	IPR001313	871	906	SM00025	Pumilio/Puf RNA-binding
	IPR001313	907	941	SM00025	Pumilio/Puf RNA-binding
	IPR001313	945	980	SM00025	Pumilio/Puf RNA-binding
	IPR001313	981	1016	SM00025	Pumilio/Puf RNA-binding
	IPR001313	1017	1052	SM00025	Pumilio/Puf RNA-binding
	IPR001313	1053	1088	SM00025	Pumilio/Puf RNA-binding
	IPR001313	1096	1131	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	815	1157	PS50303	Pumilio/Puf RNA-binding
	IPR001313	835	870	PS50302	Pumilio/Puf RNA-binding
	IPR001313	871	906	PS50302	Pumilio/Puf RNA-binding
	IPR001313	907	944	PS50302	Pumilio/Puf RNA-binding
	IPR001313	945	980	PS50302	Pumilio/Puf RNA-binding
	IPR001313	981	1016	PS50302	Pumilio/Puf RNA-binding
	IPR001313	1017	1052	PS50302	Pumilio/Puf RNA-binding
	IPR001313	1053	1088	PS50302	Pumilio/Puf RNA-binding
	IPR001313	1092	1131	PS50302	Pumilio/Puf RNA-binding

Primer_f
Primer_r
PCR conditions	test