KIAA0794

Product ID	ORK00641
Accession No	AB018337
Description	UBX domain protein 7
Clone name	hk06006
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4656 bp) Predicted protein sequence (490 aa)
HaloTag ORF Clone	FHC00641
Flexi ORF Clone	FXC00641
Source	Human adult brain
Rouge ID	mKIAA0794 by Kazusa Mouse cDNA Project

Length: 4656 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3183 bp
Genome contig ID	gi89161205r_197465055
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCTGGGCGACAAAGCGACACTCCATCTCAAATTT
Flanking genome sequence (99713 - 99664)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGAAGAAGAAGAAGAAAACTAGTGGGAAAAAAGTGAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	197564768	197643670	11	99.3	Perfect prediction

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94888	3.1e-198	100.0	UBX domain-cont...	Homo sapiens
CAH89670	1.2e-197	99.8	hypothetical pr...	Pongo abelii
CAH90918	1.2e-197	99.8	hypothetical pr...	Pongo abelii
XP_545151	9.3e-196	98.4	similar to CG88...	Canis lupus fam...
XP_001499653	1.7e-195	98.2	similar to mCG1...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001012	408	488	PF00789	UBX
HMMSmart	IPR006577	138	261	SM00594	UAS
HMMSmart	IPR001012	406	488	SM00166	UBX
ProfileScan	IPR001012	409	486	PS50033	UBX

Primer_f	CATGGGAAGAGTTACGGATTG
Primer_r	GGCAAACTGGAAGAAGCATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-