KIAA0855

Product ID	ORK00660
Accession No	AB020662
Description	golgin A8 family, member A
Clone name	hk06219
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4241 bp) Predicted protein sequence (632 aa)
HaloTag ORF Clone	FHC00660
Flexi ORF Clone	FXC00660
Source	Human adult brain

Length: 4241 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2340 bp
Genome contig ID	gi51511731r_32358564
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGCTACTGTAATGCAATAAATTTTTAAATTGTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTGCTGTTTTTGCCTTAAAATTTTATTTTGCGTGTCTTGAAAACTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	32458564	32466537	15	99.2	Perfect prediction
Ensembl gnome browser	15	r	32604778	32612758	15	98.0	Perfect prediction

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI50330	2.8e-177	100.0	GOLGA8A protein...	Homo sapiens
A7E2F4	5.2e-177	100.0	Golgin subfamil...	Homo sapiens
NP_851422	6.3e-151	98.9	golgi autoantig...	Homo sapiens
A8MQT2	9.4e-151	98.7	Golgin subfamil...	Homo sapiens
AAH93673	3.6e-150	98.5	Golgi autoantig...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	AAAGAGGGCAGATATTGGGTC
Primer_r	GGGCTAGAAATCATACGACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 15

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GGGCTAGAAATCATACGACTG
Primer_r	AAAGAGGGCAGATATTGGGTC
PCR product length	150 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles