Gene/Protein Characteristic Table for KIAA0915
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00681
Accession No AB020722
Description Rho guanine nucleotide exchange factor (GEF) 15, transcript variant 2
Clone name hk06275s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4114 bp)
Predicted protein sequence (846 aa)
Flexi ORF Clone FXC00681
Source Human adult brain
Rouge ID mKIAA0915 by Kazusa Mouse cDNA Project
Note We replaced hk06275, former representative clones for KIAA0915 with hk06275s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4114 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1517 bp
Genome contig ID gi51511734f_8056033
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
TGTGGGGAACCCTCAGTAAATAGTGGTGCATTTGT
Flanking genome sequence
(110522 - 110571)
----+----*----+----*----+----*----+----*----+----*
ATTGAGGCTCTCTGAGGAAGTGTGTGCTTATAGGAGCAGTGGTCTCCAAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 f 8154885 8166553 16 99.6 Perfect prediction
Features of the protein sequence
Description

Length: 846 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09898 0 100.0 Rho guanine nuc...
synthetic construct
EAW90060 0 99.9 Rho guanine nuc...
Homo sapiens
O94989 0 99.9 Rho guanine nuc...
Homo sapiens
AAH36749 0 99.8 Rho guanine nuc...
Homo sapiens
XP_001166994 0 99.2 Rho guanine exc...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 426 605 PF00621 DH
HMMSmart IPR000219 426 605 SM00325 DH
ProfileScan IPR000219 422 606 PS50010 DH
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AACTTGCCCAGGACTGACACT
Primer_r CCACTATTTACTGAGGGTTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f AACTTGCCCAGGACTGACACT
Primer_r CCACTATTTACTGAGGGTTCC
PCR product length 157 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp