KIAA0915

Product ID	ORK00681
Accession No	AB020722
Description	Rho guanine nucleotide exchange factor (GEF) 15, transcript variant 2
Clone name	hk06275s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4114 bp) Predicted protein sequence (846 aa)
HaloTag ORF Clone	FHC00681
Flexi ORF Clone	FXC00681
Source	Human adult brain
Rouge ID	mKIAA0915 by Kazusa Mouse cDNA Project
Note	We replaced hk06275, former representative clones for KIAA0915 with hk06275s1. (2002/5/10)

Length: 4114 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1517 bp
Genome contig ID	gi51511734f_8056033
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TGTGGGGAACCCTCAGTAAATAGTGGTGCATTTGT
Flanking genome sequence (110522 - 110571)	----+--------+--------+--------+--------+----* ATTGAGGCTCTCTGAGGAAGTGTGTGCTTATAGGAGCAGTGGTCTCCAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	8154885	8166553	16	99.6	Perfect prediction

Length: 846 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09898	100.0	Rho guanine nuc...	synthetic construct
EAW90060	99.9	Rho guanine nuc...	Homo sapiens
O94989	99.9	Rho guanine nuc...	Homo sapiens
AAH36749	99.8	Rho guanine nuc...	Homo sapiens
XP_001166994	99.2	Rho guanine exc...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	426	605	PF00621	DH
HMMSmart	IPR000219	426	605	SM00325	DH
ProfileScan	IPR000219	422	606	PS50010	DH

Primer_f	AACTTGCCCAGGACTGACACT
Primer_r	CCACTATTTACTGAGGGTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACTTGCCCAGGACTGACACT
Primer_r	CCACTATTTACTGAGGGTTCC
PCR product length	157 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles