KIAA0797

Product ID	ORK00642
Accession No	AB018340
Description	SUMO1/sentrin specific peptidase 6, transcript variant 1
Clone name	hk06406s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-278) was subcloned upstream of the cDNA (279-4254). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTTGATT-5' end of cDNA This cDNA clone hk06406s1 has an unexpected insertion (T) between the vector and the cDNA.
cDNA sequence	DNA sequence (4254 bp) Predicted protein sequence (1126 aa)
HaloTag ORF Clone	FHC00642
Flexi ORF Clone	FXC00642
Source	Human adult brain
Rouge ID	mKIAA0797 by Kazusa Mouse cDNA Project
Note	We replaced hk06406, former representative clones for KIAA0797 with hk06406s1. (2002/12/27)

Length: 4254 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	871 bp
Genome contig ID	gi89161210f_76268917
PolyA signal sequence (None)	+--------+--------+----*----+---- ACAGGAATTTAAATAGGAATTTACTATTTTTTTAT
Flanking genome sequence (213986 - 214035)	----+--------+--------+--------+--------+----* AAAGCTTTTGCTATTTTTTCATTGCTCATTTTGTTCTTATTATTTTGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	76368917	76482901	24	99.6	Perfect prediction

Length: 1126 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_518592	99.1	SUMO1/sentrin s...	Pan troglodytes
AAF04852	100.0	SUMO-1-specific...	Homo sapiens
Q9GZR1	99.8	Sentrin-specifi...	Homo sapiens
AAG29831	99.7	sentrin-specifi...	Homo sapiens
EAW48735	99.6	SUMO1/sentrin s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051494	1e-20	29.6	KIAA1707

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003653	680	1088	PF02902	Peptidase C48
ProfileScan	IPR003653	680	1055	PS50600	Peptidase C48

Primer_f	AGTTCAGAAATAGGACAGTGG
Primer_r	GTGGTACTTTTGGATTAGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-