KIAA1270

Product ID	ORK02025
Accession No	AB033096
Description	alanyl-tRNA synthetase 2, mitochondrial
Clone name	hk06471
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3970 bp) Predicted protein sequence (986 aa)
HaloTag ORF Clone	FHC02025
Flexi ORF Clone	FXC02025
Source	Human adult brain
Rouge ID	mKIAA1270 by Kazusa Mouse cDNA Project

Length: 3970 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1009 bp
Genome contig ID	gi89161210r_44275370
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GAAACAGGAAATAAAGCAAAAGAAGAGGGTCAGGC
Flanking genome sequence (99902 - 99853)	----+--------+--------+--------+--------+----* TTGGTGGCTCATGCCTATAATCCTGGCATTTTAGGAGGCTGAGGTTGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	44375272	44389041	23	99.5	Internal No-hit

Length: 986 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI31729	100.0	Alanyl-tRNA syn...	Homo sapiens
Q5JTZ9	99.9	Probable alanyl...	Homo sapiens
XP_518510	99.6	alanyl-tRNA syn...	Pan troglodytes
XP_001099647	95.7	similar to alan...	Macaca mulatta
XP_532155	87.4	similar to alan...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002318	117	128	PR00980	Alanyl-tRNA synthetase
	IPR002318	239	250	PR00980	Alanyl-tRNA synthetase
	IPR002318	266	279	PR00980	Alanyl-tRNA synthetase
	IPR002318	323	339	PR00980	Alanyl-tRNA synthetase
	IPR002318	347	360	PR00980	Alanyl-tRNA synthetase
HMMPfam	IPR002318	42	625	PF01411	Alanyl-tRNA synthetase
HMMPfam	IPR012947	722	780	PF07973	Threonyl/alanyl tRNA synthetase
HMMTigr	IPR002318	42	966	TIGR00344	Alanyl-tRNA synthetase
ProfileScan	IPR002318	38	793	PS50860	Alanyl-tRNA synthetase

Primer_f	GGGACCCACATGGACTAAAGG
Primer_r	TAGCCCATGTCTCCTTGTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGACCCACATGGACTAAAGG
Primer_r	TAGCCCATGTCTCCTTGTGTC
PCR product length	157 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles