KIAA0860

Product ID	ORK00663
Accession No	AB020667
Description	U-box domain containing 5, transcript variant 1
Clone name	hk06518
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4313 bp) Predicted protein sequence (551 aa)
HaloTag ORF Clone	FHC00663
Flexi ORF Clone	FXC00663
Source	Human adult brain
Rouge ID	mKIAA0860 by Kazusa Mouse cDNA Project

Length: 4313 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2533 bp
Genome contig ID	gi51511747r_2936220
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CCCTAGAAAATGGGAATAAAATTTCTTTTGCTGTC
Flanking genome sequence (252305 - 252256)	----+--------+--------+--------+--------+----* CCCAGAGTTAATTCTGCCTCCTGGTACCATTTCAGTATTCTATGTGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	3019818	3088524	9	98.6	Terminal No-hit

Length: 551 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94941	0	100.0	RING finger pro...	Homo sapiens
BAD96596	0	99.8	ubiquitin conju...	Homo sapiens
XP_001160362	0	99.4	U-box domain co...	Pan troglodytes
XP_001115116	0	97.8	U-box domain co...	Macaca mulatta
XP_542922	1.7e-201	89.6	similar to RING...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	268	348	PF04564	U box
HMMSmart	IPR003613	272	341	SM00504	U box
ProfileScan	IPR001841	493	538	PS50089	Zinc finger
ScanRegExp	IPR001841	514	523	PS00518	Zinc finger

Primer_f	TTCCCTTCTAAGCACGTTTGG
Primer_r	GTATTGGGTGTGGACTAGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-