KIAA0916

Product ID	ORK06069
Accession No	AB020723
Description	MYC binding protein 2, E3 ubiquitin protein ligase
Clone name	hk06582s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326GW (Amp-r) vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. The original pYO326 shuttle vector (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4354 bp) Predicted protein sequence (1210 aa)
Source	Human adult brain
Note	We replaced hk06582, former representative clones for KIAA0916 with hk06582s1. (2002/5/10)

Length: 4354 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	720 bp
Genome contig ID	gi51511729r_76416794
PolyA signal sequence (GATAAA,-10)	+--------+--------+----*----+---- AAACCACTGTACATTTTTATACAGTGATAAAGTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCACTGTGGGAGGTATTGTTTAAAAAACAAAATTTGAACACCTTTAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	76516794	76562363	24	100.0	Perfect prediction

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75592	100.0	Probable E3 ubi...	Homo sapiens
XP_001140575	99.9	MYC binding pro...	Pan troglodytes
AAC39928	99.9	protein associa...	Homo sapiens
XP_857946	99.5	similar to Prob...	Canis lupus fam...
EAW80566	99.8	MYC binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001841	960	1010	SM00184	Zinc finger
ProfileScan	IPR001841	960	1011	PS50089	Zinc finger

Primer_f	TTGGCCTGTGAAGCATTGGAC
Primer_r	CTCTTTTTATCCCCACCCGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-