KIAA0869

Product ID	ORK07373
Accession No	AB020676
Description	WW and C2 domain containing 1
Clone name	hk06927
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3408 bp) Predicted protein sequence (888 aa)
Source	Human adult brain
Rouge ID	mKIAA0869 by Kazusa Mouse cDNA Project

Length: 3408 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	740 bp
Genome contig ID	gi51511721f_167665862
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTATCTCCATCAATAAAGTGGCCTTTCAAAAAG
Flanking genome sequence (163480 - 163529)	----+--------+--------+--------+--------+----* AATCTTCCTCTTGCTCTCTTTTTCTTTCCTACCCCTCACTTCATCTGTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	167765862	167829340	18	99.8	Perfect prediction

Length: 888 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW61508	100.0	WW, C2 and coil...	Homo sapiens
AAQ09942	99.9	HBeAg-binding p...	Homo sapiens
EAW61509	99.9	WW, C2 and coil...	Homo sapiens
Q8IX03	99.9	Protein WWC1; W...	Homo sapiens
BAG59017	99.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033106	2.9e-22	39.8	KIAA1280

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AATGCCTGGGGGACGGTAATC
Primer_r	AACACGTCACAGCTCAAGAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-