KIAA0871

Product ID	ORK00666
Accession No	AB020678
Description	RUN and FYVE domain containing 3, transcript variant 2
Clone name	hk06991
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4207 bp) Predicted protein sequence (471 aa)
HaloTag ORF Clone	FHC00666
Flexi ORF Clone	FXC00666
Source	Human adult brain
Rouge ID	mKIAA0871 by Kazusa Mouse cDNA Project

Length: 4207 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2259 bp
Genome contig ID	gi89161207f_71706618
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAACTGTAGTACTAGAATAAAAAAAATGGAAAATC
Flanking genome sequence (171521 - 171570)	----+--------+--------+--------+--------+----* AGCTTTTCCTCTGCCTGGTTCACCTTCATCTTACTTTTCTTTAGAATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	71806618	71878137	13	99.3	Perfect prediction

Length: 471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7L099	4e-160	100.0	Protein RUFY3; ...	Homo sapiens
Q5R4V2	1.3e-159	99.8	Protein RUFY3.	Pongo abelii
ABZ92309	1.7e-159	99.8	RUN and FYVE do...	synthetic construct
XP_532400	1.9e-159	99.4	similar to rap2...	Canis lupus fam...
Q5FVJ0	6e-159	99.1	Protein RUFY3; ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040970	3e-39	62.9	KIAA1537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	105	229	PF02759	RUN
HMMSmart	IPR004012	165	227	SM00593	RUN
ProfileScan	IPR004012	97	229	PS50826	RUN

Primer_f	GGAAGGAGTGATCAAATACCG
Primer_r	AAGATGTGTGACTAAGTGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-