Order Kazusa clone(s) from : ![]() |
Product ID | ORK00004 |
---|---|
Accession No | D13643 |
Description | 24-dehydrocholesterol reductase |
Clone name | hk07284 |
Vector information | |
cDNA sequence | DNA sequence (4268 bp) Predicted protein sequence (553 aa) |
HaloTag ORF Clone |
FHC00004
![]() |
Flexi ORF Clone | FXC00004 |
Source | Human adult brain |
Rouge ID |
mKIAA0018
by Kazusa Mouse cDNA Project
|
Note | We replaced ha00517, former representative clones for KIAA0018 with hk07284. (2001/10/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2605 bp |
---|---|
Genome contig ID | gi89161185r_54987889 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 55087889 | 55125493 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006094 | 151 | 240 | PF01565 | FAD linked oxidase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 40 | PAVSLAVCALLFLLWVRLKGLEF | 62 | PRIMARY | 23 | 2 | 74 | LFLLPLSLIFDIYYYVRAWVVFK | 96 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | TTGGCCAGAAGGATGAATAC |
Primer_r | AGTGCCTGTGGCTGTAAGAG |
PCR product length | 156 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |