KIAA0874

Product ID	ORK04106
Accession No	AB020681
Description	ankyrin repeat domain 12
Clone name	hk07302
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4440 bp) Predicted protein sequence (601 aa)
Source	Human adult brain
Rouge ID	mKIAA0874 by Kazusa Mouse cDNA Project

Length: 4440 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2632 bp
Genome contig ID	gi51511735f_9147647
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGCATGTTATTTAATAAAGAGTTATATTTTTATAG
Flanking genome sequence (126112 - 126161)	----+--------+--------+--------+--------+----* AAAAAAAGAGTGAAATGTGTGCTAACTGTTTTTTTACTTAATTTTACTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	9247647	9273757	5	99.4	Perfect prediction

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAS45545	100.0	ankyrin repeat-...	Homo sapiens
CAH56382	100.0	hypothetical pr...	Homo sapiens
AAR25662	100.0	ankyrin repeat-...	Homo sapiens
Q6UB98	100.0	Ankyrin repeat ...	Homo sapiens
XP_001139090	99.8	ankyrin repeat ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	CACTCTCTTAAATGGTACCTC
Primer_r	TTCAGGCATATACTCCATTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 18

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CACTCTCTTAAATGGTACCTC
Primer_r	TTCAGGCATATACTCCATTCC
PCR product length	227 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles