KIAA1168

Product ID	ORK00193
Accession No	AB032994
Description	cytoplasmic FMR1 interacting protein 2, transcript variant 5
Clone name	hk07410
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4149 bp) Predicted protein sequence (1304 aa)
HaloTag ORF Clone	FHC00193
Flexi ORF Clone	FXC00193
Source	Human adult brain
Rouge ID	mKIAA1168 by Kazusa Mouse cDNA Project
Note	We replaced hk08280, former representative clones for KIAA1168 with hk07410. (2007/2/9)

Length: 4149 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	233 bp
Genome contig ID	gi51511721f_156525728
PolyA signal sequence (AGTAAA,-10)	+--------+--------+----*----+---- GCATAAATGAAAAAAAAAAAAAAAAAGTAAACAGG
Flanking genome sequence (227093 - 227142)	----+--------+--------+--------+--------+----* GCAGTGTGTGCTTTTTCTTTTCTCCCCCCTCAACTATATTAAGAACTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	156625728	156752819	32	99.9	Perfect prediction

Length: 1304 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001105005	99.6	similar to cyto...	Macaca mulatta
XP_536455	99.6	similar to p53 ...	Canis lupus fam...
BAG10431	100.0	cytoplasmic FMR...	synthetic construct
Q96F07	99.9	Cytoplasmic FMR...	Homo sapiens
XP_001136888	99.9	cytoplasmic FMR...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38549	0	85.0	KIAA0068

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008081	70	87	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	125	141	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	165	194	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	286	301	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	602	625	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	665	683	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	734	756	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	794	824	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	1130	1154	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	1176	1192	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
	IPR008081	1251	1265	PR01698	Cytoplasmic fragile X mental retardation protein interacting protein
HMMPfam	IPR008081	27	1304	PF05994	Cytoplasmic fragile X mental retardation protein interacting protein

Primer_f	TCCAGCCTTATTACCTCTATG
Primer_r	CACAATCTTTAGCAGTTCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-