Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01613 |
---|---|
Accession No | AB020687 |
Description | solute carrier organic anion transporter family, member 2B1, transcript variant 1 |
Clone name | hk07457 |
Vector information | |
cDNA sequence | DNA sequence (4068 bp) Predicted protein sequence (727 aa) |
HaloTag ORF Clone |
FHC01613
|
Flexi ORF Clone | FXC01613 |
Source | Human adult brain |
Rouge ID |
mKIAA0880
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1672 bp |
---|---|
Genome contig ID | gi51511727f_74439809 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (155138 - 155187) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 74539809 | 74594945 | 14 | 99.8 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004156 | 66 | 666 | PF03137 | Organic anion transporter polypeptide OATP |
HMMTigr | IPR004156 | 35 | 693 | TIGR00805 | Organic anion transporter polypeptide OATP |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 62 | VFHNIKLFVLCHSLLQLAQLMIS | 84 | SECONDARY | 23 | 2 | 135 | MIGYGAILVALAGLLMTLPHFIS | 157 | PRIMARY | 23 | 3 | 207 | VGIMFVAQTLLGVGGVPIQPFGI | 229 | SECONDARY | 23 | 4 | 244 | YLGILFAVTMMGPGLAFGLGSLM | 266 | SECONDARY | 23 | 5 | 293 | AWWLGFLIAAGAVALAAIPYFFF | 315 | PRIMARY | 23 | 6 | 393 | LVVLSQVCLSSMAAGMATFLPKF | 415 | SECONDARY | 23 | 7 | 427 | ANLLIGCLSFPSVIVGIVVGGVL | 449 | PRIMARY | 23 | 8 | 459 | GCGALCLLGMLLCLFFSLPLFFI | 481 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GAGCATGTATCTATCAACGCC |
---|---|
Primer_r | CTGCAAAACCTGGGAAACAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTGCAAAACCTGGGAAACAAG |
Primer_r | GAGCATGTATCTATCAACGCC |
PCR product length | 105 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |