KIAA0992

Product ID	ORK00710
Accession No	AB023209
Description	palladin, cytoskeletal associated protein, transcript variant 4
Clone name	hk07554
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4347 bp) Predicted protein sequence (772 aa)
HaloTag ORF Clone	FHC00710
Flexi ORF Clone	FXC00710
Source	Human adult brain
Rouge ID	mKIAA0992 by Kazusa Mouse cDNA Project

Length: 4347 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2028 bp
Genome contig ID	gi89161207f_169889767
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AATGTGGATTTAACATCAATAAATATTTGACAAAT
Flanking genome sequence (196376 - 196425)	----+--------+--------+--------+--------+----* AATAGTTGCAGTTTTGTGAAGCAAAATAAATATTCAGTTTTAGTTTTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	169989767	170086141	12	99.3	Perfect prediction

Length: 772 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8WX93	1.5e-185	99.5	Palladin; Sarco...	Homo sapiens
BAG09933	5.7e-170	100.0	palladin [synth...	synthetic construct
AAH76588	9.9e-163	88.5	Palld protein [...	Mus musculus
AAI61407	1e-140	76.9	Palld protein [...	Xenopus (Silura...
AAH13867	3.5e-125	100.0	PALLD protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	390	481	PF07679	Immunoglobulin I-set
	IPR013098	524	614	PF07679	Immunoglobulin I-set
	IPR013098	623	714	PF07679	Immunoglobulin I-set
HMMSmart	IPR003599	396	482	SM00409	Immunoglobulin subtype
	IPR003598	402	471	SM00408	Immunoglobulin subtype 2
	IPR003599	530	615	SM00409	Immunoglobulin subtype
	IPR003598	536	604	SM00408	Immunoglobulin subtype 2
	IPR003599	629	715	SM00409	Immunoglobulin subtype
	IPR003598	635	704	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	390	474	PS50835	Immunoglobulin-like
	IPR007110	524	615	PS50835	Immunoglobulin-like
	IPR007110	622	713	PS50835	Immunoglobulin-like

Primer_f	TGCTGATTTGCTGGGTTTGGG
Primer_r	TCCACATTACACCAGCACAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCTGATTTGCTGGGTTTGGG
Primer_r	TCCACATTACACCAGCACAAC
PCR product length	122 bp
PCR conditions	95 °C15 sec65 °C60 sec35 cycles