KIAA1125

Product ID	ORK00743
Accession No	AB032951
Description	zinc finger, MYND-type containing 8
Clone name	hk07594
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4147 bp) Predicted protein sequence (1205 aa)
HaloTag ORF Clone	FHC00743
Flexi ORF Clone	FXC00743
Source	Human adult brain
Rouge ID	mKIAA1125 by Kazusa Mouse cDNA Project

Length: 4147 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	332 bp
Genome contig ID	gi51511747r_45172512
PolyA signal sequence (ATTAAA,-34)	+--------+--------+----*----+---- TATTAAAAAAAAAAAAAGAAAAAGAAAAACGATTT
Flanking genome sequence (99969 - 99920)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGCAACCAACCCCAACAACAAAAAAGAATGTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	45272481	45417808	22	99.9	Perfect prediction

Length: 1205 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
ABC86690	100.0	RACK7 isoform k...	Homo sapiens
XP_514699	99.3	protein kinase ...	Pan troglodytes
CAH93498	99.2	hypothetical pr...	Pongo abelii
Q9ULU4	100.0	Protein kinase ...	Homo sapiens
XP_001163843	99.3	protein kinase ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	109	152	PF00628	Zinc finger
	IPR001487	173	259	PF00439	Bromodomain
	IPR000313	293	357	PF00855	PWWP
	IPR002893	1047	1081	PF01753	Zinc finger
HMMSmart	IPR001965	109	150	SM00249	Zinc finger
	IPR001487	166	273	SM00297	Bromodomain
	IPR000313	294	344	SM00293	PWWP
ProfileScan	IPR001965	107	152	PS50016	Zinc finger
	IPR001487	184	254	PS50014	Bromodomain
	IPR000313	296	346	PS50812	PWWP
	IPR002893	1047	1081	PS50865	Zinc finger
ScanRegExp	IPR001965	110	149	PS01359	Zinc finger
ScanRegExp	IPR002893	1047	1081	PS01360	Zinc finger

Primer_f	GCACACAATCAGCACCTTCAG
Primer_r	TCTCATCACTGCTGCTCCAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-