Gene/Protein Characteristic Table for KIAA0884
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05272
Accession No AB020691
Description Ral GTPase activating protein, alpha subunit 1 (catalytic)
Clone name hk07674
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4487 bp)
Predicted protein sequence (943 aa)
Source Human adult brain
Rouge ID mKIAA0884 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4487 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 14 r 35215186 35299851 17 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 943 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW65871 0 99.9 GTPase activati...
Homo sapiens
EAW65870 0 98.1 GTPase activati...
Homo sapiens
EAW65869 0 98.1 GTPase activati...
Homo sapiens
AAI45120 0 91.3 Unknown (protei...
Mus musculus
EAW65868 0 93.1 GTPase activati...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTCAGATAGTCATTCGGATTC
Primer_r CACATCAGCAGAGGACGTAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 14
Experimental conditions
Panel name GeneBridge 4
Primer_f CTCAGATAGTCATTCGGATTC
Primer_r CACATCAGCAGAGGACGTAAC
PCR product length 106 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp