KIAA0885

Product ID	ORK00672
Accession No	AB020692
Description	cold shock domain containing E1, RNA-binding, transcript variant 1
Clone name	hk07709
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4076 bp) Predicted protein sequence (826 aa)
HaloTag ORF Clone	FHC00672
Flexi ORF Clone	FXC00672
Source	Human adult brain
Rouge ID	mKIAA0885 by Kazusa Mouse cDNA Project

Length: 4076 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1252 bp
Genome contig ID	gi89161185r_114961061
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GAAGCGAATAAAGTTTTACTGATTTTTGAGACACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCACCTAGCGCTTTCATTATTGAAACGTCCCGTGTGGGAGGGGCGGGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	115061061	115102108	20	100.0	Perfect prediction

Length: 826 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001160588	99.9	upstream of NRA...	Pan troglodytes
EDL07606	97.6	cold shock doma...	Mus musculus
EAW56616	99.6	cold shock doma...	Homo sapiens
O75534	100.0	Cold shock doma...	Homo sapiens
CAH18231	99.5	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002059	53	118	PF00313	Cold-shock protein
	IPR002059	213	276	PF00313	Cold-shock protein
	IPR002059	376	441	PF00313	Cold-shock protein
	IPR002059	546	610	PF00313	Cold-shock protein
	IPR002059	701	766	PF00313	Cold-shock protein
HMMSmart	IPR011129	55	118	SM00357	Cold shock protein
	IPR011129	215	276	SM00357	Cold shock protein
	IPR011129	378	441	SM00357	Cold shock protein
	IPR011129	548	610	SM00357	Cold shock protein
	IPR011129	703	766	SM00357	Cold shock protein
ScanRegExp	IPR002059	65	84	PS00352	Cold-shock protein
	IPR002016	71	82	PS00436	Haem peroxidase
	IPR002059	225	244	PS00352	Cold-shock protein
	IPR002059	388	407	PS00352	Cold-shock protein
	IPR002059	558	577	PS00352	Cold-shock protein

Primer_f	TCTTCCCCCTTGTCGTTTGAG
Primer_r	TATTCGCTTCCATTCTTTCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-