Order Kazusa clone(s) from : ![]() |
Product ID | ORK00673 |
---|---|
Accession No | AB020693 |
Description | reticulon 4, transcript variant 1 |
Clone name | hk07722 |
Vector information | |
cDNA sequence | DNA sequence (4053 bp) Predicted protein sequence (1233 aa) |
HaloTag ORF Clone |
FHC00673
![]() |
Flexi ORF Clone | FXC00673 |
Source | Human adult brain |
Rouge ID |
mKIAA0886
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 340 bp |
---|---|
Genome contig ID | gi89161199r_54953452 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 55053452 | 55131074 | 9 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003388 | 1046 | 1231 | PF02453 | Reticulon |
ProfileScan | IPR003388 | 1046 | 1233 | PS50845 | Reticulon |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1047 | VDLLYWRDIKKTGVVFGASLFLL | 1069 | SECONDARY | 23 | 2 | 1075 | FSIVSVTAYIALALLSVTISFRI | 1097 | PRIMARY | 23 | 3 | 1150 | LFLVDDLVDSLKFAVLMWVFTYV | 1172 | PRIMARY | 23 | 4 | 1176 | FNGLTLLILALISLFSVPVIYER | 1198 | PRIMARY | 23 |
---|
![]() |
Primer_f | GATTATACGGGGGAGGGTCAG |
---|---|
Primer_r | ACACATGGCAGTCAAGACAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GATTATACGGGGGAGGGTCAG |
Primer_r | ACACATGGCAGTCAAGACAGG |
PCR product length | 131 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |