Order Kazusa clone(s) from : ![]() |
Product ID | ORK06296 |
---|---|
Accession No | AB023212 |
Description | pecanex homolog (Drosophila) |
Clone name | hk07740 |
Vector information | |
cDNA sequence | DNA sequence (4410 bp) Predicted protein sequence (1014 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1364 bp |
---|---|
Genome contig ID | gi51511730f_70343875 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (205415 - 205464) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 70443875 | 70549288 | 10 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 80 | LLLSGLLLLVCCLLLLLQQ | 98 | PRIMARY | 19 | 2 | 130 | GAGAGTAAAAAATAAAPGGDGVA | 152 | SECONDARY | 23 | 3 | 181 | RAAPLPVALLLGLPFTLYMALPS | 203 | PRIMARY | 23 | 4 | 207 | IVAVYCPVIAAVFIVLKMVNYRL | 229 | PRIMARY | 23 |
---|
![]() |
Primer_f | GTGGGAAGAAATGAGAGTTGC |
---|---|
Primer_r | TCGTTAGTGGCTTCTCTTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTGGGAAGAAATGAGAGTTGC |
Primer_r | TCGTTAGTGGCTTCTCTTCTC |
PCR product length | 124 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |