KIAA0996

Product ID	ORK00162
Accession No	AB023213
Description	DAZ interacting zinc finger protein 1, transcript variant 1
Clone name	hk07913
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4502 bp) Predicted protein sequence (869 aa)
HaloTag ORF Clone	FHC00162
Flexi ORF Clone	FXC00162
Source	Human adult brain
Rouge ID	mKIAA0996 by Kazusa Mouse cDNA Project

Length: 4502 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1117 bp
Genome contig ID	gi51511729r_94931372
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TTGTCAACCTTTTCAGTAAAGCCCTCTGTTACATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTGTGACTGTGGCTGTGTTATTAGAGATGAATTCTGAGTTAAATTTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	95031372	95094945	22	100.0	Perfect prediction

Length: 869 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH71600	100.0	DAZ interacting...	Homo sapiens
EAX08958	99.9	DAZ interacting...	Homo sapiens
XP_001137818	99.2	DAZ interacting...	Pan troglodytes
XP_001085701	96.3	similar to DAZ ...	Macaca mulatta
XP_001137916	95.7	DAZ interacting...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	219	242	PF00096	Zinc finger
HMMSmart	IPR015880	219	242	SM00355	Zinc finger
ProfileScan	IPR007087	219	247	PS50157	Zinc finger
ScanRegExp	IPR007087	221	242	PS00028	Zinc finger

Primer_f	GTTTAAGACTTCCGCTGCTGC
Primer_r	GCCTACGATACGACAGCATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTTAAGACTTCCGCTGCTGC
Primer_r	GCCTACGATACGACAGCATAC
PCR product length	202 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles