KIAA0888

Gene/Protein Characteristic Table for KIAA0888

Order Kazusa clone(s) from :

Product ID	ORK00675
Accession No	AB020695
Description	family with sequence similarity 169, member A, transcript variant 1
Clone name	hk07993
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3882 bp) Predicted protein sequence (684 aa)
HaloTag ORF Clone	FHC00675
Flexi ORF Clone	FXC00675
Source	Human adult brain
Rouge ID	mKIAA0888 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3882 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1826 bp
Genome contig ID	gi51511721r_74011215
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCATTTATTTTTTCAACAAATGCTAATACTAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGTATGACTACTATTAGTGAATCTACCAAACATTTATGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	74111215	74198371	13	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 684 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF82693	0	99.9	unnamed protein...	Homo sapiens
XP_001099174	0	95.9	hypothetical pr...	Macaca mulatta
XP_544374	2e-214	90.4	similar to CG14...	Canis lupus fam...
XP_597523	3.1e-209	88.1	hypothetical pr...	Bos taurus
AAH84589	1.8e-189	79.6	B230112C05Rik p...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTTGGAGAATGTTTTGAGACC
Primer_r	CTTTCAACATCAGTCCTTAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 5

Experimental conditions

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp