KIAA0890

Product ID	ORK01131
Accession No	AB020697
Description	DEAH (Asp-Glu-Ala-His) box helicase 30, transcript variant 1
Clone name	hk08057
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3800 bp) Predicted protein sequence (1210 aa)
HaloTag ORF Clone	FHC01131
Flexi ORF Clone	FXC01131
Source	Human adult brain
Rouge ID	mKIAA0890 by Kazusa Mouse cDNA Project

Length: 3800 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	72 bp
Genome contig ID	gi89161205f_47721817
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTTTATTTAAAATAAAGTTCTATTTATCCCTTGTG
Flanking genome sequence (144871 - 144920)	----+--------+--------+--------+--------+----* ACCACTGCTGTCCACTAGGGGCTCCTCTCTCAGGGCCTCCATACACTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	47819686	47866686	22	100.0	Perfect prediction

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L2E3	100.0	Putative ATP-de...	Homo sapiens
ABM85195	99.9	DEAH (Asp-Glu-A...	synthetic construct
XP_001113204	99.6	similar to DEAH...	Macaca mulatta
Q5R607	99.6	Putative ATP-de...	Pongo abelii
NP_001125306	99.6	DEAH (Asp-Glu-A...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040921	4.3e-44	36.5	KIAA1488
AB011149	3.3e-20	29.1	KIAA0577
D86977	1.3e-19	30.1	KIAA0224
D50924	1.1e-18	30.7	KIAA0134
AB040950	2.4e-12	27.8	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001159	69	137	PF00035	Double-stranded RNA binding
	IPR011545	453	616	PF00270	DNA/RNA helicase
	IPR001650	709	803	PF00271	DNA/RNA helicase
	IPR007502	866	956	PF04408	Helicase-associated region
	IPR011709	996	1123	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	448	637	SM00487	DEAD-like helicases
HMMSmart	IPR001650	698	803	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	460	628	PS51192	Helicase
ProfileScan	IPR001650	670	843	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	570	579	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	901	KAIVLAAIFRCLHPLLVVVSCLT	923	PRIMARY	23

Primer_f	AACATCCTGCTGCACAAGTCG
Primer_r	ACGAAGACGCTGCCATTGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACATCCTGCTGCACAAGTCG
Primer_r	ACGAAGACGCTGCCATTGGAC
PCR product length	104 (0.2k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles