KIAA0892

Product ID	ORK01132
Accession No	AB020699
Description	MAU2 sister chromatid cohesion factor
Clone name	hk08289
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4164 bp) Predicted protein sequence (621 aa)
HaloTag ORF Clone	FHC01132
Flexi ORF Clone	FXC01132
Source	Human adult brain
Rouge ID	mKIAA0892 by Kazusa Mouse cDNA Project

Length: 4164 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2297 bp
Genome contig ID	gi42406306f_19192734
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCAGCCTGGGTGACGGTGAGACTTTGTCTC
Flanking genome sequence (137156 - 137205)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAACAATGGAAGGCAGACAGCAAGTCCCTGAGGACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	19292644	19329888	18	99.1	Perfect prediction

Length: 621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44991	98.9	9130404D08Rik p...	Mus musculus
EDL28773	98.6	RIKEN cDNA 9130...	Mus musculus
XP_512526	99.8	hypothetical pr...	Pan troglodytes
BAC33653	98.5	unnamed protein...	Mus musculus
BAC38382	98.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR013026	115	148	SM00028	Tetratricopeptide region
	IPR013026	387	420	SM00028	Tetratricopeptide region
	IPR013026	467	500	SM00028	Tetratricopeptide region

Primer_f	ACGGCGTGCATCATGTTCATC
Primer_r	ATAGATAACAGGGTGGTCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-