KIAA1035

Product ID	ORK04066
Accession No	AB028958
Description	ATP/GTP binding protein 1
Clone name	hk08527
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4394 bp) Predicted protein sequence (1220 aa)
Source	Human adult brain
Rouge ID	mKIAA1035 by Kazusa Mouse cDNA Project
Note	We replaced fh00984, former representative clones for KIAA1035 with hk08527. (2002/5/10)

Length: 4394 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	567 bp
Genome contig ID	gi89161216r_87251277
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACCAAATTAAACAAATAAAAACTGTATTAAATGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCATTCATTTTGTCATCTTCTTTAACCAGCTCAGATTATTTGATGTATAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	87351277	87546621	26	100.0	Perfect prediction

Length: 1220 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPW5	99.9	Cytosolic carbo...	Homo sapiens
XP_001136238	99.8	ATP/GTP binding...	Pan troglodytes
XP_001107818	99.3	similar to ATP/...	Macaca mulatta
Q641K1	90.4	Cytosolic carbo...	Mus musculus
EDL93892	89.7	ATP/GTP binding...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000834	849	1127	PF00246	Peptidase M14

Primer_f	CTCTTCCAGCATCACACCTTC
Primer_r	GGTAAGGACATGAGGCAGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-